Tetracycline resistance gene classification:
Class B
© Service of Biosafety & Biotechnology
- Author:
Jean-Marc Collard
Last revised:
| MECHANISM |
|
Efflux | 12-TMS (Transmembrane segments) |
| Ribosomal protection | |||
| Enzymatic | |||
| Unknown |
| MINOCYCLINE RESISTANCE |
|
YES |
|
NO |
| DISTRIBUTION | Gram-negatives: Actinobacillus, Aeromonas, Citrobacter, Enterobacter, Escherichia, Haemophilus, Klebsiella, Moraxella, Pasteurella, Plesiomonas, Proteus, Providencia, Salmonella, Serratia, Shigella, Treponema, Yersinia, Vibrio |
| REPRESENTATIVES | Tn10 |
| GENETIC LOCATION | Transposon |
| SOURCE | Escherichia coli |
| SEQUENCE ACCESS NB | V00611 (Ref. 2) |
| PROTEIN WEIGHT | 43.3 kDa (Calculated) (Ref. 2) |
| PROBES | 1,275-bp HincII fragment of pRT29 (1, 3, 5) 1,275-bp HincII fragment of pRT11 (1, 5, 6) CAGTGCTGTTGTTGTCATTAATA (275-297) (7) |
| PCR PRIMERS | see reference 8 |
| REFERENCES | |
| 1 | Jorgensen, R. A., and W. S. Reznikoff. 1979. Organisation of structural and regulatory genes that mediate tetracycline resistance in transposon Tn10. J. Bacteriol. 138:705-714. |
| 2 | Hillen, W., and K. Schollmeier. 1983. Nucleotide sequence of the Tn10 encoded tetracycline resistance gene. Nucleic Acids Res. 11:525-539. |
| 3 | Lee, C. Y., B. E. Langlois, and K. A. Dawson. 1993. Detection of tetracycline resistance determinants in pig isolates from three herds with different histories of antimicrobial agent exposure. Appl. Environ. Microbiol. 59:1467-1472. |
| 4 | Andersen, S. R, and R. A. Sandaa. 1994. Distribution of tetracycline resistance determinants among Gram-negative bacteria isolated from polluted and unpolluted marine-sediments. Appl. Environ. Microbiol. 60:908-912. |
| 5 | Roe, D. E., P. H. Braham, A. Weinberg, and M. C. Roberts. 1995. Characterization of tetracycline resistance in Actinobacillus actinomycetemcomitans. Oral Microbiol. Immunol. 10:227-232. |
| 6 | Chaslus-Dancla, E., M.-C. Lesage-Descauses, S. Leroy-Sétrin, J.-L. Martel, and J.-P. Lafont. 1995. Tetracycline resistance determinants, Tet B and Tet M, detected in Pasteurella multocida from bovine herds. J. Antimicrob. Chemother. 36:815-819. |
| 7 | DePaola, A., W. E. Hill, and F. M. Harrel. 1993. Oligonucleotide probe determination of tetracycline-resistant bacteria isolated from catfish ponds. Mol. Cell. Probes 7:345-348. |
| 8 | Hansen, L. M., P. C. Blanchard, and D. C. Hirsh. 1996. Distribution of tet(H) among Pasteurella isolates from the United States and Canada. Antimicrob. Agents Chemother. 40:1558-1560. |