Tetracycline resistance gene classification: Class C

© Service of Biosafety & Biotechnology - Author: Jean-Marc Collard
Last revised: May 27, 1998


MECHANISM

Efflux 12-TMS (Transmembrane segments)
    Ribosomal protection  
    Enzymatic  
    Unknown  

MINOCYCLINE RESISTANCE

YES

NO



DISTRIBUTION Gram-negatives: Citrobacter, Enterobacter, Escherichia, Proteus, Pseudomonas, Salmonella, Serratia, Shigella, Vibrio


REPRESENTATIVES pBR322 (Ref. 1) pTR50
GENETIC LOCATION plasmid plasmid
SOURCE plasmid pSC101 Escherichia coli O157:H7
SEQUENCE ACCESS NB J01749; K00005; L08654; M10282; M10283; M10286; M10356; M10784; M10785 (Ref. 2, 3) AB023657 (Unpublished)


PROTEIN WEIGHT 43.63 kDa (Calculated) (Ref.3)
PROBES 929-bp BstNI fragment of pBR322 (3, 4, 5, 6)
TTGCATGCACCATTCCTTGCG (460-480) (8)
PCR PRIMERS see reference 9


  REFERENCES
1 Bolivar, F. et al. 1977. Gene 2:95-113
2 Sutcliffe, J. G. 1979. Complete nucleotide sequence of the Escherichia coli plasmid pBR322. Cold Spring Harb. Symp. Quant. Biol. 0:77-90.
3 Peden, K. W. C. 1983. Revised sequence of the tetracycline resistance gene of pBR322. Gene 22:277-280.
4 Lee, C. Y., B. E. Langlois, and K. A. Dawson. 1993. Detection of tetracycline resistance determinants in pig isolates from three herds with different histories of antimicrobial agent exposure. Appl. Environ. Microbiol. 59:1467-1472.
5 Andersen, S. R, and R. A. Sandaa. 1994. Distribution of tetracycline resistance determinants among Gram-negative bacteria isolated from polluted and unpolluted marine-sediments. Appl. Environ. Microbiol. 60:908-912.
6 Roe, D. E., P. H. Braham, A. Weinberg, and M. C. Roberts. 1995. Characterization of tetracycline resistance in Actinobacillus actinomycetemcomitans. Oral Microbiol. Immunol. 10:227-232.
7 Chaslus-Dancla, E., M.-C. Lesage-Descauses, S. Leroy-Sétrin, J.-L. Martel, and J.-P. Lafont. 1995. Tetracycline resistance determinants, Tet B and Tet M, detected in Pasteurella multocida from bovine herds. J. Antimicrob. Chemother. 36:815-819.
8 DePaola, A., W. E. Hill, and F. M. Harrel. 1993. Oligonucleotide probe determination of tetracycline-resistant bacteria isolated from catfish ponds. Mol. Cell. Probes 7:345-348.
9 Hansen, L. M., P. C. Blanchard, and D. C. Hirsh. 1996. Distribution of tet(H) among Pasteurella isolates from the United States and Canada. Antimicrob. Agents Chemother. 40:1558-1560.